Which one is the correct product of DNA dependent RNA polymerase to the given template?3'TACATGG....

Channel:
PW Solutions
Subscribers:
486,000
Published on ● Video Link: https://www.youtube.com/watch?v=4yLMgYjsonY


Duration: 2:40
4 views
0

Which one is the correct product of DNA dependent RNA polymerase to the given template?3'TACATGGCAAATATCCATTCA5' šŸ“²PW App Link - https://bit.ly/YTAI_PWAP šŸŒPW Website - https://www.pw.live



Other Videos By PW Solutions


2024-05-09Match List I with List II : List IA. Down's syndrome            &n....
2024-05-09The "Ti plasmid" of Agrobacterium tumefaciens stands for....
2024-05-09Following are the stages of cell division :A. Gap 2 phaseB. CytokinesisC. Synthesis phaseD. Kary....
2024-05-09Following are the stages of pathway for conduction of an action potential through the heart:A. A....
2024-05-09Match List I with List II :    List I              ....
2024-05-09Match List I with List II :        List I          ....
2024-05-09Match List I with List II : List I                 ....
2024-05-09The flippers of the Penguins and Dolphins are the example of the....
2024-05-09Match List I with List II :        List I          ....
2024-05-09Given below are two statements : one is labelled as Assertion A and the other is labelled as Rea....
2024-05-09Which one is the correct product of DNA dependent RNA polymerase to the given template?3'TACATGG....
2024-05-09Given below are two statements :Statement I : The presence or absence of hymen is not a reliable....
2024-05-09Match List I with List II  List I                &n....
2024-05-09 Match List I with List II :       List I        &n....
2024-05-09Choose the correct answer from the options given below : ....
2024-05-09Choose the correct answer from the options given below : ....
2024-05-09Choose the correct answer from the options given below : List I         &nbs....
2024-05-09Given below are two statements : one is labelled as Assertion A and the other is labelled as Rea....
2024-05-09Which of the following factors are favourable for the formation of oxyhaemoglobin in alveoli?....
2024-05-09Match List I with List II Choose the correct answer from the options given below :....
2024-05-09Which of the following are Autoimmune disorders?A. Myasthenia gravisB. Rheumatoid arthritisC. Go....